Euskal Oiloa Chicken Forum

A place to find out more and share what you know about this awesome rare poultry breed! **NOTE: Those who wish to register as a new member on the forum are asked to email eochickenforum@gmail.com and an Administrator will gladly help you join the forum!

You are not logged in.

Adverts

Adverts

#1 2012-01-15 04:58:30

ipf
Member
From: Salt Spring Island, BC, Canada
Registered: 2011-08-29
Posts: 168

Chromosomes, genes, alleles

This is someihing I recently posted on another forum - it might be useful here. . .?

There are 78 chromosomes; 39 pairs. Some are bigger, some are smaller; it isn’t really that big a deal. Two of them ARE a big deal, the W and Z, the sex chromosomes. I’m not going to go into those right now. The two members of each pair are the same size (apart from W and Z). (think of W as the "W"oman chromosome - only she has it.)

A DNA molecule is a long thin double spiral strand (the famous "double helix"), made up of lots of repeated building blocks called nucleotides. These individual chunks contain a five-carbon sugar, a phosphate group and a base. The bases are the key; there are only four different ones, names are abbreviated to C, G, A and T. Different sequences of these nucleotides make up genes.

Each chromosome is a single DNA molecule. Normally, in a cell that’s just sitting around doing celly things, each chromosome has wound itself up into a short fat sausage. They just float around (separately, not bound to their pair-buddies) in the cell nucleus, which is enclosed by the nuclear membrane, which separates the nuclear stuff from all the other celly stuff (mitochondria, ribosomes, etc.). When the cell divides, the chromosome unwinds itself to its full long skinny length, pairs up with its pair buddy, and replicates. But that’s another story.

Now think of a single one of those chromosomes. Or rather let’s think of two, a pair of them. Each one of this chromosome pair, as I said above, is a single molecule of DNA. A long skinny spiral molecule. Think of the building blocks as letters, and sequences of them as words. Genes are simply sequences of these four nucleotides (which I'll abbreviate by the symbol of their rescpective base); so genes =”words”. So, we could have a “word” spelled CCGATTCGGGGTTCCAA.

Geneticists tend to use the terms "gene" and "allele" somewhat interchangeably sometimes. I’m guilty of that, I know. The gene is the generalized "word" (nucleotide sequence); the alleles are slightly different spellings of that "word". I’m going to pretend that the gene I’ve spelled above is the blue allele, “O” for the blue/non-blue egg colour gene. (It isn’t, but let’s pretend). There is an alternate form of that gene, “o”, that codes for non-blue eggs. It is very likely spelt only slightly differently, maybe CCGAATCGGGGTTCCAA. Spot the difference? The fifth nucleotide (letter) is an A instead of a T, but the word is otherwise the same. So, an allele is just a slightly different spelling of a word. BUT (and here the analogy breaks down) it changes the meaning of the word, too.

So, back to the chromosome. It can be thought of as a very long sentence, with these genes=words making up this sentence. The two members of a chromosome pair (remember they all come in pairs) are the same length, in fact they are EXACTLY the same sentence, in EXACTLY the same word order. However a few words may be spelled differently on each member of the pair. One chromosome may say “blue egg” at that word location (=locus, location on the chromosome), while the other says “non-blue egg”. Since blue is dominant, this bird, if female, will lay blue eggs. The word sequence on this chromosome pair is EXACTLY the same in every single chicken (well, there may be a mutant or two out there). This is important.

On this same chromosome pair is another word (gene) that means pea comb, or non-pea comb. Again, I’m making this sequence up – the allele for pea comb (P) might be GGCCTTTATATGGCCCCTTTTAAGCCCAATTAAACCGG. Note (that these words are not all the same length – some words(=genes) are short; some are excruciatingly long) The allele for non-pea comb (p) could be GGCCTTTATATGGCACCTTTTAAGCCCAATTAAACCGG – recognizably the same word; slightly different spelling, and so different effect.

Because these two genes, O and P, are on the same chromosome pair, they are described as linked. These two are quite close together on the pair (tightly linked).

Last edited by ipf (2012-01-15 05:00:07)

Offline

 

2012-01-15 04:58:30

AdBot
Advertisements

#2 2012-01-15 13:44:24

Maggiesdad
Moderator
From: Louisa County, Virginia
Registered: 2011-10-05
Posts: 1980

Re: Chromosomes, genes, alleles

This helps a lot! I guess when you are trying to learn a new language, one needs to start at the beginning... it's kind of tough to jump in in the middle of a technical conversation. :surfing:

I really appreciate your input.
Glen

Offline

 

#3 2012-01-15 14:50:52

poplar girl
Administrator
From: Athabasca, AB, Canada
Registered: 2011-06-30
Posts: 3159

Re: Chromosomes, genes, alleles

I saw that ipf...I was hoping you would transfer it here! :thanks:


Raising red cuckoo (marraduna) Euskal Oiloak and self blue (lavender) & black Belgian Bearded d'Uccles.

Offline

 

#4 2012-01-16 02:30:04

skeffling lavender farm
Administrator
From: Wiarton, ON, Canada
Registered: 2011-06-17
Posts: 2720
Website

Re: Chromosomes, genes, alleles

That is great IPF!  :wise:  It does help a lot.   :thanks:

Offline

 

#5 2012-01-17 02:11:00

ChestnutRidge
Member
From: Western Virginia
Registered: 2011-07-05
Posts: 251
Website

Re: Chromosomes, genes, alleles

Awesome!!! :thumbs:

Is there a chapter two? ;) :lol: :surfing:

I can see it now: Chicken Genetics for Dummies!  Or something like that....

Ahem, present company and myself excluded, of course. :chairhide:

Last edited by ChestnutRidge (2012-01-17 02:13:23)

Offline

 

#6 2012-01-17 04:02:37

Maggiesdad
Moderator
From: Louisa County, Virginia
Registered: 2011-10-05
Posts: 1980

Re: Chromosomes, genes, alleles

No, that resembles me very much!  :oops:

Offline

 

Adverts

Board footer

Powered by FluxBB
Hosted by PunBB-Hosting